Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712026
Length 715 bp
Fasta Format > whva11g15
tcatggcatcaaagcgcatcctcaaggaactgaaggacctgcagaaggac ccgcccacatcatgcagcgcaggtcctgctggtgaggacatgtttcattg gcaagcaacaattatgggaccccctgacagtccctatgccggcggtgttt tcttagtgaacattcatttccctccagattaccccttcaagccaccaaag gtatcttttaagacaaaggtcttccatcctaatatcaacagcaatggaag catatgccttgatattcttaaggagcagtggagccctgctttgacgatct ccaaggtcttgctctctatctgttccctgctgaccgatcccaacccggat gatccccttgttcctgagattgcccacatgtacaagacggaccggtcaaa gtatgagacgacagcccgcagctggacgcagaagtacgccatgggttgaa gacctgcatcgtggacaactgaaatgtcgcttcaagaaaaaaatttatgg gccattgtttcttcgatttgttgctggttgtgtgtaatccgatcctcaag gattgtaaattgcattcggcgtcggccctatcatcaattgccactagtat cggcagacatgcatgcctatcagcctattcacctatgcttgttgggttaa ccttcatcantgttggtgttatttggtaaatgttcattaaaacatgtttt gcttcaaaaaaaaaa
Download
page-top