Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712023
Length 922 bp
Fasta Format > whva11g09
caatctcgtctccgatcgaccccaggctcgtcgaatcctcctcccccgcc gcctcaagatgcagatctttgtgaagaccctcaccggcaagaccatcacc ctcgaggttgagagctccgacaccatcgacaacgtcaaggccaagatcca ggacaaggagggcattcccccggaccagcagcgccttatctttgctggca agcagctggaggatggccgcacccttgctgactacaacatccagaaggag tccaccctccaccttgtcctgcggctgcgtggtggcatgcagatcttcgt caagaccctcactggcaagaccatcacccttgaggttgagagctccgaca ccattgacaacgtcaaggccaagatccaggacaaggagggcattcctccg gaccagcagcgcctcatctttgctggcaagcagctggaggatggtcgcac cctcgctgactacaacatccagaaggagtccaccctccaccttgtcctgc gtctgcgtggtggcatgcagatcttcgtgaagaccctcaccggcaagacc gtcacacttgaggtggagtcgtctgacaccattgacaatgtcaaggccaa gatccaggacaaggagggcattcccccggaccagcagcgccttatctttg ctggcaagcagctggaggatggccgtacccttgctgactacaacatccag aaggagtccacccttcaccttgtcctccgccttcggggaggcatgcagat cttcgtcaagaccctcaccggnaagaccatcacgcttgaggtggagtctt ctgacaccatcgacaacgtcaaggccaagatccatgnacaaggaagggna ttnccccccggancaggcagcgcccttnattctttngcanggcaagcaan ctgggaaggatgggccgcaccc
Download
page-top