Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712020
Length 755 bp
Fasta Format > whva11g04
gtcctcgccgtccccaacctctcgctgcaaaaggttgcttgtcatggcat caaagcgcatcctcaaggaactgaaggacctgcagaaggacccgcccaca tcatgcagcgcaggtcctgctggtgaggacatgtttcattggcaagcaac aattatgggaccccctgacagtccctatgccggcggtgttttcttagtga acattcatttccctccagattaccccttcaagccaccaaaggtatctttt aagacaaaggtcttccatcctaatatcaacagcaatggaagcatatgcct tgatattcttaaggagcagtggagccctgctttgacgatctccaaggtct tgctctctatctgttccctgctgaccgatcccaacccggatgatcccctt gttcctgagattgcccacatgtacaagacggaccggtcaaagtatgagac gacagcccgcagctggacgcagaagtacgccatgggttgaagacctgcat cgtggacaactgaaatgtcgcttcaagaaaaaaatttatgggccattgtt tcttcgatttgttgctggttgtgtgtaatccgatcctcaaggattgtaaa ttgcattcggcgtcggccctatcatcaattgccactagtatcggcagaca tgcatgcctatcagcctattcacctatgcttgttgggttaaccttcatca gtgttggtgttatttggtaaatgttcattaaaacatgtttgcttcaaaaa aaaaa
Download
page-top