Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712016
Length 754 bp
Fasta Format > whva11f21
ctcgctcgctcgctcgatcgtcctctccgccgtgacgcagccagtcgcca tggcctccaccgcgctctccaccgcctccaaccctacccagctctgccgg acccgcgcaagctcgctgtgcaagcccgtcaagggcctgggcttcagccg ggagcgcgtcccgaggaacatcacctgcatggccggcagcatctccgcgg accgcgtgccggacatgagcaagagggagctgatgaacctgctcctgctg ggcgccatctcgctccccaccttcggcatgctcgtcccctacggttcctt cctcgtcccggccggctccgggagcaacgccggaggggtcgccgccaagg acaagctcggcaacgacatcctcgtcgaggactggctcaagacgcacggc cccaacgaccgcacgctcgcccaggggctcaagggtgatcctacctacct tgtggtggagtccgacaagaccctcgccacctacgggatcaacgccgtgt gcacgcatcttggatgcgtcgtgccgtggaacgccgccgagaacaagttc ctctgcccctgccatggatcccagtacaacaaccagggcaaggttgtccg tgggcctgcacctctgtcgctggcccttgttcacgccgacgtcgacgacg gcaaggtcgtcttcgtgccgtgggtggagaccgacttcaggaccggcgac aacccgtggtggaaataagcgacgcaagctccgggcagccaatgctcact cgtg
Download
page-top