Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712011
Length 817 bp
Fasta Format > whva11f14
gtttgctgcacaacattaccagtatccagcttattatcagcctcctaccc cgatttcttctacaactcaaggtgaccagcagcattcagccaatgctgat aataagccagcagctaaggcagatgctgccaaaacaaccacaaatgttgt tcctaatggtactgctcagagtaacagcggaactgctccccttgggtcaa gctaccagaattcatcactgacccctgatggaacctatagggcacccttg ataggtggagtcccttctactggttacgtggactcaacctatgggtatga caccacaggggcacactatgcttggtatgatggttctgcctataccaatg cacagcaaagaccaactacagctaattacacgccgtcttcagcgtataat agcaatggctcttctgcaaggtatcagaccaagagccccacaccgcagca gacgggcaacaggagaccaacgactacaacagggtcagctactcctacat acccaaacaggatgtactcgagcacccagtcttacaaccagtacggaaat tcggtcaaaactggtcttatgtatggaaacactggctacggaagcactgg ctacggaagcactggctatggaagcagcggctatggcggcagtggctacg gaagcaatggctatgattccaggttatatggtcggtggggtgtttctatg gatagcagatacaacaggcccagaggccgtggcaacggatattatggttt tggcaatgagagtcaggatggaacaattgagctcaacagaggtcctaggt ctgggtcgtttcaagaa
Download
page-top