Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712006
Length 804 bp
Fasta Format > whva11f08
catcgtcgctccctccactctgaattcccctccccttctctcggtgaagg tcctcaccggcgcccccgctgccacggctctctctccaaatcgtcgccga tccgagaatttccattcaacagcaaggtcatggcagaaaccattgatcta acaggggatggaggcgttcttaagacggtggtcagaaaagcaaaagatga tgctataagcccatctgacagccttccattggttgatgttcattatgaag ggacacttgctgaaaatggcgaagtttttgacaccacacatgaagacaat tctatttttacatttgaagttggccagggagctgtcattaaagcatggga catagccttaagaactatgaaagttggcgagattgcaaaaataacatgca ggccggaatatgcgtatggaagtccaggctcgccaccagagataccagcc aatgcaacactcatttttgaggtggaattagtggcttgcaagccaaggaa aggttcaagtctgggcagtgtatctgatgagaaagccaggctagaggagc ttaagaaacagcgggagctggcagctgccaccaaagaggaagagaagaag aagagggaggaggcaaaggccgcggcagcggctcgtgtgcaagccaaact tgacgccaagaagggcaagggaaaaggaaagggcaaatagattactccca actgatgtattagtagttgcatttgctgctgagtgccgactgttgtaacc tactccctccgtcgcataaaagaaaacatcttacattgtgggacgaagta gtac
Download
page-top