Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711999
Length 498 bp
Fasta Format > whva11e24
cccccctcttcctacattggtttgtttgttgcgttctttctcaggagata tgctgcagcattaataacatctacagtgatacacatgttacactgatgag atgattgtcatcggctggctgcatctttcgatcctggttggcataagctg aagctagcatgtcaacatggaggacagtttttgccaaatcttcaaactaa acgagagatggcctgaagctacttgcagaagtgtctttatctatctatcc gggcttgacctacttgctgcacggtattggtagggcgccctgtattaaag cgacttgtcttcactatagtttgcctagttgttggtccggaaaagcagat gggatacggtaccgcatacccacccggtttggatgtggtttaattaggac ttgttgctgtctttggacaagactttttacctactgtttattaatgggtg tgacctgcaccaccgccaccgggcaatttgcatcgaataaaaaaaaaa
Download
page-top