Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711998
Length 769 bp
Fasta Format > whva11e23
tggcccccactgtgatggcttcctcggccacctccgtcgcacccttccag ggtctcaagtccaccgcgggcctgcccgtcagccgccgctccagcagcgc cggcctcggcagcgtcagcaacggcggaaggatcaggtgcatgcaggtgt ggccgattgagggcatcaagaagttcgagaccctgtcttacttgccaccc ctctccacggaggccctcctgaagcaggtcgactacttgatccgctccaa gtgggtgccctgcctcgagttcagcaaggttggcttcgttttccgtgagc acaacagctcccccgggtactacgatggtcgatactggacaatgtggaag ctgcctatgttcgggtgcaccgacgccacacaggtgctcaacgaggtgga ggaggtcaagaaggagtaccctgacgcctatgtccgcgtcatcggcttcg acaacctgcgccaggtgcagtgcgtcagcttcatcgccttcaggccaccg ggttgcgaggagtctggcaaggcctaaactacgagttgaaacaatggcct atgtatgaaggtcttttgtgaacttaacttttgtccaccactctgctgga cgaccagagcatatttttcattctatatggtctgtgtgtgtatgtacgaa cataggttctcgagcatgcatatgtaaattctanaaccggctacacatat acaaaacctgtgtgatatttattatatacaaacacgcggaccattgtctt gctgttattaaaaaaaaaa
Download
page-top