Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711996
Length 508 bp
Fasta Format > whva11e21
ggcaaaatttgatatttcgagttacttgctcgaaaggaacatatattcgg tccctctgtgcagacttggggaaagcgcttcgaagctgtgctcatttaac tgcccttcggagggactcaattggtgactattcggtcaatgatgcttgga acttcgacgaactgcaagaacaaatcaccaagggatacctatgagaattg gccatgccctttggaagattgcgatcgagagcagctatttctagacatgt ggtggactgaggcactgagcactcatggtcgtggtgcaagccgctgatgc agcagtatggtctacatgaatctgcaatctgacttcttaggtctccttgg agtcaaggaattcatttgttaagcctgaacaatgtatgactgtcgcagtt ctgttatttgcaaaactatagtgaatggatagccctatgttttgcaaaac tatacagatgtccaatacattatttttgatcaaatatggtgcgattctaa aaaaaaaa
Download
page-top