Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711984
Length 518 bp
Fasta Format > whva11e02
gtaatcggagccggaggagacccgaggaagaaggagaagcggcgcggcga ggcgcggcgaggagaaagatggggaagatgccggtgcggatgaaggcggt ggtgtacgcgctgtcgccgttccagcagcaggtgatgccgggcctgtgga aggacatcaccaccaagatccaccacaaggtgtccgagaactggatctcc gccacgctcctcatcacccccgtcgtcggcacctaccagtacgcgatgta ctacaaggagcaggagaagctgtcccacagatactagatgtgaagctttg tcaaatgtcaaagcagttggaatttccatgttctataatccgccaagagt gatttaacatttttggaatcatttcctagttgtactcttttcctctttcc atgcatatgcaatgatgcagtaagtgcgacttgcaaacttactttgaggc tcaaatgttgtgctatccatcgttggagtaattgttgaataaagcaaatt aactcgtcaaaaaaaaaa
Download
page-top