Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711982
Length 719 bp
Fasta Format > whva11d23
tggcttcgtcggctaccaccgntcgcacccttccaggggctcaagtccac agccggtctgcccgtcagccgccgctccagcggcagcctcggccgcgtca gcaatggcggaaggatcaggtgcatgcaggtgtggccgattgagggtatc aagaagttcgagaccctgtcttacttgccacccctctccacagaggccct cctaaagcaggtagactacctgatccgctccaagtgggtgccctgcctcg agttcagcaaggttggcttcgtcttccgtgagcacaacagctctcccgga tactacgacggtcgatactggacaatgtggaagctgcctatgttcgggtg caccgacgccacgcaggtgctcaacgaggtggaggaggtcaagaaggagt accctgatgcctatgtccgtgtcatcggcttcgacaacctgcgccaggtg cagtgcgtcagcttcatcgccttcaggccaccaggttgcgaggagtccgg caaggcctaaactacaagttgaaacaatggcctatgtatgatggtcattt gtgaacttcacttttgtccacgactctgctttccgaccagagcatatttc tcgttccatatgatctgtgtttgtacgaacataggttgtggagcatgcat atgtaaattctagcgaaaaatctatactgaagtcgagaggggctcggggc tccgctgctaaaaaaaaaa
Download
page-top