Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711975
Length 855 bp
Fasta Format > whva11d11
agcaagctatatacctacatagtacagccatggcccccaccgtgatggcc tcgtcggccacctccgtcgctcctttccaggggctcaagtccaccgccgg cctccccgtcagccgccgctccaacggcgctagcctcggcagcgtcagca acggtggaaggatcaggtgcatgcaggtgtggcccattgagggcatcaag aagttcgagaccctgtcctacttgccaccgctcagcacggaggccctcct caagcaggtcgactacctgatccgctccaagtgggtgccttgcctcgagt tcagcaaggttgggttcatcttccgtgagcacaacgcatcccctgggtac tatgatggccggtactggacaatgtggaagctgcctatgttcgggtgcac cgacgccacacaagtgatcaacgaggtggaggaggtcaagaaggagtacc ctgacgcgtatgtccgcatcatcggattcgacaacatgcgccaggtgcag tgcgtcagcttcatcgccttcaagccaccgggctgcgaggagtccggcaa ggcctaaacagctcactcacgacaggccatatataaagtgccattgcagt tttgtcaactctgacattgctttgggttttccttctccatttatctttct tatttgttcctaagaatatgtgtatgtccatgttcatgtaccaacatggc tcgagaaagcatgctcgtatgagaatgctatcggtggctatgtatatgaa cggacgcataatattatacaatatgtcgactatatacgttttaatggtaa ccaatggaaaatatctccaccaccgtgcttattacttcctctgtaaatta atata
Download
page-top