Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711973
Length 815 bp
Fasta Format > whva11d09
gcctcctcctagcaagctatatacctacatagtacagccatggcccccac cgtgatggcctcgtcggccacctccgtcgctcctttccaggggctcaagt ccaccgccggcctccccgtcagccgccgctccaacggcgctagcctcggc agcgtcagcaacggtggaaggatcaggtgcatgcaggtgtggcccatcga gggcatcaagaagttcgagaccctgtcttacctgccaccgctcagcacgg aggccctcctcaagcaggtggactacctgatccgctccaagtgggtgcct tgccttgagttcagcaaggtcgggttcatcttccgtgagcacaatgcgtc tcccgggtactacgacggccgctactggacaatgtggaagctgcctatgt tcgggtgcaccgacgccacacaggtgatcaacgaggtggaggaggtcaag aaggagtaccctgacgcgtacgtccgcatcatcggattcgacaacatgcg ccaggtgcagtgcgtcagcttcattgccttcaagccaccgggctgcgagg agtccggcaaggcctaaacagctcactcaccacgggccacatataaagtg ccattgcagttttgtcaactctgacattgctttgggttttccttctccat ttgtctttcttacttgttcctaanaatatgtgtatgtccatgttcatgta acaacatggctcgagaaagcgtgctcgtatgtgaatgcaatcggtggcta tgtatatgcacatgcacataatatattatacaatctgtcnactatgtatt cgggtaaaaaaaaaa
Download
page-top