Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711972
Length 823 bp
Fasta Format > whva11d08
ttcatcaccgatcaccagcacagccgcgcatccaccgttgctagcaaggt cgaccaagcagcaccgagatggctgctgccttctcctccaccgtcggtgc cccggcttctacgccgaccaacttccttgggaagaagctcaagaagcagg tgacctcggccgtgaactaccatggcaagagctccaaggccaacaggttc acagtcatggcagcggaaaacctcgacgagaagaggaacacggacaagtg gaagggtcttgcgtacgatatctccgacgaccagcaggacatcaccagag ggaagggcatcgtggactcgctcttccaggcgcccacgggcgacggcacc cacgaggccgtcctcagctcctacgagtacgtcagccagggactcaagaa gtacgacttcgacaacaccatgggaggcttctacatcgctcctgctttca tggacaagcttgttgtccatctctccaagaacttcatgaccctgcccaac atcaagatcccactcatcttgggtatctggggaggcaagggtcaaggaaa atcattccagtgcgagcttgtcttcgccaagatgggcatcaacccaatca tgatgagtgccggagagctggagagtggcaacgccggagagccagccaag ctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaagggtaa gatgtgctgcctcttcatcaacgatcttgacgctggtgcgggtcggatgg gcgggaccacacagtacaccgtcaacaaccagatggtgaacgccaccctc atgaacatcgccgatgcccccac
Download
page-top