Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711970
Length 490 bp
Fasta Format > whva11d02
ccacactccatatggttgaacttcgtaaaactggaggggacaccttggag tttcacagtttctacaagaatttctcatcagaactaaaagacattgtgtg gaaaactgaatccaacacaattgcgaaatagtcgcgatgattgatacttt gcggaatggaactatcttgcggtgctgtatcgatggaccaccccttgagg tgataccgctgggcgctgggtactgtatatttctccggcaccgcatcgat ggtccagttccgccgtctcttgttgaagacagcgccttttttttaccgag cgcgattgtacaattacatgtacaacgaggccctcccggacatgctcctt gtaatattgcaacggggtgcctaacaggcatcctgaatgtgctttagttt gcaccagggttgtgtgccttcctttatttttgtattggaagtatttaaga atcgtaagatgaataaaggtagttcagactaaaaaaaaaa
Download
page-top