Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711967
Length 795 bp
Fasta Format > whva11c21
tttggttggtggacacagacacacaagacgaacacggcggtacagatggc gtccccgtcctcgtcgctctgctccagcctcggctacccgcgcgccgcct ccctcggcgcccgccgccgcgccggcttctcctcgtccaggaagctattc caagtgaaggcatcaagggtcgacagtttctccaagagtgacatcattgt gtccccttccattctctctgcaaacttcgccaagcttggtgaacaggtaa aagctgtggaggtggcaggatgtgactggattcatgttgatgtcatggac ggtcgctttgtgccaaacatcacgattggaccattgattgttgatgctct gcgtccagtgactgatcttccattggatgtgcatctgatgattgtggaac ctgagcagcgaattcctgattttatcaaggcaggtgctgatattgttagc gtccactgtgagcaaacggcaaccatccatctgcaccgaacagtcgatca gattaaaagtctaggagcaaaggctggagttgttttgaaccctgggaccc cactcagtgcgatagaatatgtacttgaatctgttgatctggtattgatt atgtcagtcaaccctgggtttggtgggcaaagcttcattgagagccaagt aaagaaaattgctgatttgagaaaattatgtgaagagaagggagtgaacc cctggattgaggttgatggtggagtcagccccaaaaatgcctacaaggtc attgaagctggcgcgaatgcccttgttgctggttctgcggttttc
Download
page-top