Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711960
Length 807 bp
Fasta Format > whva11c11
agctgttcaggttttctctggtggcaagccagtggacttcacagctgaat ccatcgcacctgaggtctcaagctcaattcctcctagccttgtgcgcgac agcccctacttgactcacccaatctttagcatgtaccacactgagcacga gctcctccgttacctgcataagttgcaatccaaggatctctcactgtgcc acagtatgatccctcttggttcttgcaccatgaaactaaatgctaccgtc gagatgatgcctgtcaccgatcccaagttcgccaacatgcacccatttgc ccctattgatcaagctgctggctatcatgaaatgtttgacaacctgggcg atctgttgaacaccatcactggttttgattcgttctctttgcaaccgaat gctggtgcttcaggagagtatgctggactgatggttattcgggcctacca caaggcaagaggagaccaccaccgaaatgtctgcatcattcctgtctctg cgcacggtacaaaccctgcaagtgctgctatgtgtggaatgaagattgtt gccgttggaactgatgccaaaggtaacattaacattgaggagttgaggaa agctgctgaagcaaacaaggacaacctgtctgctctgatggttacctatc cttcaacccatggagtctatgaagaaggcattgatgagatatgcaggatt attcatgagaacggcggtcaggtctatatggatggagctaacatgaacgc tcaggttggggttgacaagccctggttttattggagcagatgtttgccat cttaacc
Download
page-top