Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711955
Length 824 bp
Fasta Format > whva11b24
tcattcatcactgatcaccagcacagccgcgcatccaccgctgctagcaa ggtcgagcaagcagcacagagatggctgctgccttctcctccaccgtcgg tgccccggcttctacgccgaccaacttcctcgggaagaagctcaagaagc aggtgacctcggccgtgaactaccatggcaagagctccaaggccaacagg ttcacggtcatggcagcggaaaacatcgacgagaagaggaacaccgacaa gtggaagggtcttgcgtacgatatctccgacgaccagcaggacatcacca gagggaagggcatcgtggactccctcttccaggcgcccactggcgacggc acccacgaggccgtcctcagctcatacgagtacgtcagccagggactcaa gaagtacgacttcgacaacaccatgggaggcttctacatcgctcctgctt tcatggacaagcttgttgtccatctctccaagaacttcatgaccctgccc aacatcaagatcccactcatcttgggtatctggggaggcaagggtcaagg aaaatccttccagtgtgagcttgtcttcgccaagatgggcatcaacccaa tcatgatgagtgccggagagctggagagtggcaacgccggagagccagcc aagctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaaggg taagatgtgctgcctcttcatcaacgatcttgacgccggtgcgggtanga tgggcgggaccacacagtacaccgtcaacaaccagatggtgaacgccacc ctcatgaacatcgccgatgccccc
Download
page-top