Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711952
Length 760 bp
Fasta Format > whva11b20
acctacatagtacagccatggcccccaccgtgatggcctcgtcggccacc tccgtcgctcctttccaggggctcaagtccaccgccggcctccccgtcag ccgccgctccaacggcgctagcctcggcagcgtcagcaacggtggaagga tcaggtgcatgcaggtgtggcccatcgagggcatcaagaagttcgagacc ctgtcttacctgccaccgctcagcacggaggccctcctcaagcaggtcga ctacctgatccgctccaagtgggtgccttgcctcgagttcagcaaggttg ggttcatcttccgtgagcacaacgcatctcctgggtactacgatggccgg tattggacaatgtggaagctgcctatgttcgggtgcactgacgccacaca ggtgatcaacgaggtggaggaggtcaagaaggagtaccctgacgcgtatg tccgcatcatcggattcgacaacatgcgtcaggtgcagtgcgtcagcttc atcgccttcaagccaccgggctgcgaggagtccggcaaggcctaaacagc tcactcacgacaggccatatataaagtgccattgcagttttgtcaactct gacattgctttgggttttccttctccatttatctttcttatttgttccta agaatatgtgtatgtccatgttcatgtaccaacatggctcgagaaagcat gctcgtatgtgaatgctatcggtggctatgtatatgcacggacgcataat attatacnat
Download
page-top