Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711947
Length 786 bp
Fasta Format > whva11b14
gcatccaccgttgctagcaaggtcgacnnancagcaccgagatggctgct gccttctcctccaccgtcggtgccccggcttctacgccgaccaacttcct cgtggaagaagctcaagaagcatggtgacctcggccgtgaactaccatgg caagagctccaaggccaacaggttcacagtcatggcagcggaaaacatcg acgagaagaggaacacanacnagtggaagggtcttgcctacgatatctcc gacgaccatcaggacatcaccagagggaagggcatcntggactccctctt ccaggcgcccacgggcgacggcacccacgaggccgtcctcagctcctacg agtacgtcagccagggactcaagaagtacgacttcgacaacaccatggga ggcttctacatcgctcctgctttcatggacaagcttgttgtccatctctc caagaacttcatgaccctgnccancatcaagatcccactcatcttgggta tctggggaggcaagggtcaaggaaaatccttccagtgtgagcttgtcttc gccaagatgggcatcaacccaatcatgatgagtgccggagagctggagag tggcaacgccggagagccagccaagctcatcaggcagcggtaccgtgagg ctgcagacatgatcaagaagggtaagatgtgctgcctcttcatcaacgat cttgacgccggtgcgggtcggatgggcgggaccacacagtacaccgtcaa caaccagatggtgaacgccaccctcatgaacatcgc
Download
page-top