Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711944
Length 765 bp
Fasta Format > whva11b05
ggacccgaacctgggtgatctatccatgaccaggatgaagcttggatgaa actaagcagaggtccgaaccgactgatgttgaagaatcagcggatgagtt gtggttaggggtgaaatgccactcgaacccagagctagctggttctcccc gaaatgcgttgaggcgcagcagttgactggacatctaggggtaaagcact gtttcggtgcgggctgcgcgagcggtaccaaatcgaggcaaactctgaat actagatatgacccaaaaataacaggggtcaaggtcggccagtgagacga tgggggataagcttcatcgtcgagagggaaacagcccggatcaccagcta aggcccctaaatgaccgctcagtgataaaggaggtgggggtgcaaagaca gccaggaggtttgcctagaagcagccaccctttaaagagtgcgtaatagc tcactgatcgagcgcccttgcgctgaagatgaacggggctaagcgatctg ccgaagctgtgggatgtcaaaatgcatcggtaggggagcgttccgcctta nagggaagcaaccgcgaaagcgggggtcgacgaagcggaagcgagaatgt cggcttgagtaacgaaaacattggtgagaatccaatgccccgaaaaccca aggtttcctccgcaaggttcgtccacggagggtgagtcagggcctaanat cangccgaaaggcgtantcnatggacaacaggtcaatattcctgtactac cccttgttggtacgg
Download
page-top