Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711942
Length 858 bp
Fasta Format > whva11a23
gacagttcgaggaattaaaaggggaaatggccttagcagccaagcatcat gaggcccaactttcatatcgtgaccttgaaattgagaaatgcaagcggga gcttgaggaagtatctgagaggcatacctatgataagtctattcttgaga ctgaaatcggagatctccaagaagtggtcaagaacttggaagggaacttg gcaaaactgtcggaagagaagttgcagcttgaggcacaggttatggagct tgaacaaacatctcacagcctagatgattcatctgctgaaattaagaagc tacaaaaggtaatcaaggatctgcaagcaagactggaaaatgattcaaat gagaagagagtgctcgaggaacgtgctatcgagtttgagcaagttcatag ggagttagaggattcgagggctgaaacagtggagctacaaactagaattg agaaactcaaagctgatctggaaggagcacttcaagagaaatcgatgttg gagggctctgtcaaggatctggaacatgccattgctagtaagttggagaa attctctcttgagaagtcctctctcgatgctgagatcctacaactgtcag aagctaatgcttctcttgaagacaagttgtcatccacagaggcgcagctt aagcaacttcatgccgaaaaggcagaagcatctgttgagagtgagaaact gatctctggattgaagcaagatattgccaatcttaagacagagctcgagt tactgtcctcacagaaagctgcagttgataataaggtgtctggtttgctg agtgatctcgcaacttgtgatgaaaagatgaaggagatggatagccactt gcatcagc
Download
page-top