Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711941
Length 454 bp
Fasta Format > whva11a22
gaggggtctcaagaggaagcccatggcgctcgtcaagaagctgcgcaagg cgaaaaaggacgctcctgctggtgagaagcctgagccagtgaggacacat cttcgtaacatgatcattgtccctgagatgattggcagccttatcggtgt ctacaatggcaagaccttcaaccaggttgagattaagcctgagatgattg gccattaccttgcagagttctctatctcctacaagccagtgaagcatggt aggcccggtattggtgccacacactcttcccggttcattcctcttaaatg agttatgccgctttctactttgaaagaattcagtacggaccatctggtgg catgtccatctagctgtctcccttgttttgaaccagttatatatctagta tttggttctgtttagctataatttcgttatgcacaatgagctgttctacc taaa
Download
page-top