Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604754
Length 214 bp
Fasta Format > rwhv3n20m02
gttctccatcatctgttaccattttacaaagatggtcccacaccgttatg tatagctcctttaggaggggtgcagctttaaggatgaacagtgtccaggt cagatcatacccttcaggaatttcatctagattcacaaaccttagttggc gaaaaacagatgccaggcttttcgtcaagcactctggttggacccagatc ttttcacatttaaa
Download
page-top