Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604740
Length 125 bp
Fasta Format > rwhv3n20l04
tgtgcaccngaanataggcagcttccacattgtccantancggncatcgt agtacccaggggatgngttgtgctcacggaagatgaanccaaccttgctg aactcgaggcaaggcacccatttgg
Download
page-top