Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ603617
Length 414 bp
Fasta Format > rwhv3n16m20
aattctccanattggacagngatattgatgncagcaatgatcttaactag atcaaccaacaaccctggacggtcagctgattccacaacaagtaaacttc tttcaggaccatcgtcatagatctctatgtgagttgctatgtccacatca accacttccgtagggggctctagcccaaaagttgcacccatggccaattg actgctagcttcaggatgatactcaagcatgttgttaataattgtcagtc ttactgcttctaacaactctgggtcatcaattttgcgaccagttgacgac tttgttatancgaacttattgtgcttgccagaagaatcnaggcaaacact anctttcacaacatttanccctaaattcctcaaggcactcatagtatcaa gaanatccccaaga
Download
page-top