Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ603469
Length 354 bp
Fasta Format > rwhv3n16e10
atgagtaggcgaggaagaaacaataacagaagctaaaatataaaccgaca ccctgggtttagattactagatacacacacaaacacacattgttgcctcg attgtttcctctccaccgatcaacccacgtacgcatgcacacaagatgag tatcttcacttctgctctgctctagttagactcgagctgcgcgtaccaca caccctggatcttgacatccttgggcgccttggcgccgaggtcggtgtct gacggctgcacgctctcgaagacgccgatcacctcgccggtctccggctt gctcttggtgacgctgagcgtgatgttgcccgtggaggaggacgcgttct tcac
Download
page-top