Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ603148
Length 660 bp
Fasta Format > rwhv3n15a17
agtagttacatgatgatctgttggtggatgataatgtctgtttttaccaa caaactaacatacaaactcttccccatatatctgatgtcacggtcactga aatggtataacaaactgctggacgccatgtacaacgacaaaagaaaactg gaaccgatgaactgaacgcatggtgaagctggtttaattattgtagacaa gagtagtcgacatggttgcaacaaaaaaggaacgataatcgagcaaggag cactagtgggcgtcctcctcctcgcagtgcttggtgtacttggccgagtc cagcaggccctccagctccgccgggctgctcggcttcaccttgatcatcc acccctcctcgtacgggctcgagttgataaggccgggggtctcggacagc tttgagttgacctcgacgacctcgccggagatgggcgagttgacgtcgct ggtggccttcacactctccacgttgccgaaggctccgccctggctcacct tcgtgccggcctccggcagctccacgaacaccacctccccgagatggccc tgggcgtggtcactgatgccaatcgtggccacggagccgtcgttcttgac ccactcntgggaggaagtgtacttcaagccatcnataacagtggagaagt atctggagat
Download
page-top