Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ603099
Length 500 bp
Fasta Format > rwhv3n14n23
gtggcacaccaaggaacgaaaaatacaaacatgaactgagaggaaataca gatacagacactcatttaggaacgtggacatgagcgagacgccggtgctt ttcttcagggcgatgccagctatatagaagtctaaaacccacaagttcag cttcagctcgtatgtatgtaagtcagctcatgaactagagatgatcatgg ttcatggatggacagggaccccaggaaccaccaccagcgggccgttaatg gtactggttccggtaccggttcccaccaccggcaggtctggcaaccccga acccgaagaagccttggactcggcgacgccggcaccgcgtgtcgctccca gtgcgccgtccttctggctcagctccctcccgtcacaggacgcgagcacc accaccaacagcagcgcgacggcgagacacttcgccattgctaactggga ggttctgaacttctgatactactgaggagacagtcttgctttagcttgtg
Download
page-top