Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ602966
Length 663 bp
Fasta Format > rwhv3n14d18
acaaaggtatgctccggtcagaaagcagagtcgtacagcagagttttgga caaaagtgaagttcacaaaagaccttcatacgagataggccattgtttca actcgtagtttaggccttgccggactcctcgcaacccggtggcctaaagg cgatgaagctgacgcactgcacctggcgcaggttgtcgaagccgatgaca cggacataggcgtcagggtactccttcttgacctcctccacctcgttcag cacctgtgtggcgtcagtgcacccgaacataggcagcttccacattgtcc agtatcggccgtcgtagtacccgggggagctgttgtgctcacggaagacg aagccaaccttgctgaactcgaggcagggcacccactttgagcggatcag gtagtcgacctgtttcaggagggcctccgtggataggggtggcaggtaag acagggtctcgaacttcttgatgccctcaattggccacacctgcatgcac ctgatccttccgccattgctgacgctgctgaggctgccgctggagcggcg gccgacggggagaccggctgtggacttgagcccctggaagggtgcgacgg tggtagccgaggaagccatcacggcgggggccatggtaatgtattatctg gaggagaggagga
Download
page-top