Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ602885
Length 717 bp
Fasta Format > rwhv3n13n24
attcatgcagaaacaatacatacaacaatacatgcgtagacacgcagcaa gttaaatacatattccacactttgtgctactttgatatgctttaataaga tggttgcatgcatcattatgatgcagagggccgagggtacacctccattt tcaaaaagaaaaaacatgcacgcagggcgcagcagcaacacaggcacacc ggatgttaaaaaaaaacaggcacaccggccaaacgtacgtagtacgtata cataacgagccgtatatacgcacaaattcctggctcttattggacgcacg ctcgcgcgtatgcgtataggtgtgctagcagctggctgaatcgcggatcg atcagcagcagctggctagcttagccgaagaagtggtgcttcttcttccc ctcgccgcggccggactcctcgtcctcgccgtcctctgccgactccttgt actccttcttctcgtggtgctcgtggaacgcgtaaccgccgctgcccacg gccgccaccgcggccacctcctcctcgatcttgtgtcggtgcgcgttctc cgggtccttcttcacctggtgcttctcgtacatggcgaaggcgccggagg cgagggtgcctatctcgccgaggtgctccttgtgcttgtgctccttctcc tccttcctgtacttctcggnctcntccctggacgacccnnactctgngtc nncnccnccggacttnt
Download
page-top