Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ602656
Length 806 bp
Fasta Format > rwhv3n13a06
ctcttccatctctagtgaagagaaatgtaaagactaccattaaagcagcc caagcgagacttactatatccatctaaattatgtctcctatttctatgaa gggattattctactattgatcaataatcatagtggaatcaagggtacaga gtcaaaaagggattccgccctaaggccatggatcaatcagttcaaggaat ttactcctaacaaattcttataggaattctggtagaattagagagcatta aaaatacgatactatagcccttttttccttaaaaaagaaagagtacggga atgatgtcctgaatagaagaagcgggaataggaagattttttattccttt tgttactctttttttttaagcaaaggacgcccgaatataccataaaatta tcgatagataaatatttattggatacctaccttacctatgtttatttttg acctaaaccctgcagccttgctttgtatcattctatgaaagaatgaagag actttatcacaactcctaaattgatttttgatcgacctatttaatctgat tctcgttagaattaagtagtccttactttagtgtatgtaggtaacataag atgtacgataaaaaaatgtataataattagtaagtcttgatattctttcg tggagtcccttcttgaatcttagattgaaaaaaaaagaatgccccttagg gacctttctttggataccaagatttctgacatcttatcctcgtattttaa aattatcaaatcgaatctcaattaagaaccaattcaaattcctataaata aaagaa
Download
page-top