Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ602461
Length 752 bp
Fasta Format > rwhv3n12c23
atgttactataagtttgacttcaatcaaagaactactcccgctcattgtg ggacggagggagtacttgcttataagaaagcacactccgtacctgatatg ttcctcacaccaccgacaatctggaaacaacattaattacattaatcctg atttggaaacaacattaattgcaattaatcttggattcaacactaattgc agcacgattactgttagatgtacaaggttatgagaagatgcacaagttaa agacaaggttaaggcacaaggaatcacaaggagaccccccaagtccccaa tccaaactcaagcccggtgtgctgcagctacagctccacaaggcccttga tgcagtaggtgcccacgaggaaccacccggccatgacggctgcgaaggcg aggagaccgagcaagaacgtcgtgccgccgaggagaacgccaagggcgag caccacaacgaacggcgccagggtcttcaccacggctcccgcgctcaccc agcggccccgaaggaacatcaccgcggccaggctcaccacgttccacttg tcgtggccggcgtagaagagccggttcaggttgttggcgacgaaggagtg gcagttgcaggtgaacaggttgtagttcctgttctgaaactcctgcacgc ctttcctcagagcaccatcccatgtcgtctctgcgccggtgtcaagaagt ttatagcactcatcaccatttaattggatgtagcgtgtaacagctccaaa gg
Download
page-top