Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ602075
Length 609 bp
Fasta Format > rwhv3n10j16
tatgcccgcgagactcaagcaatacaacaactattccatcaaatccctct ctcccttctaactttgacatcccagtttcacgatagaaatcagtctgcac agtcattttattttgtttcacgacacacaacacaccgcgcgcacgcggac acgctggcatgcacgcacgcagctccagtccaagcatggcttgaatccct agcaacagtagcagcctggatgtctagaggttgaacatgaccttgatggc gtcgcggccgcgcgcgctgacctcgaaggcctcctccacctccccctgcg agaagccgaacctgtgcgtgatgagcggcttcacgtcgatcttgccgctc cgcaggaactcgaggcacagcggccacgtgtccttgtagcggaagatccc caccacgtccacctcccggatcgccgccgacgtcagcggcaccgtcatct cgttgtgccccatccccaccaggcacaccctcccgcccggccgcgtcgcc tccagcgcggtcgacatcgtcttgctgaacccggcgcagtccaggctcac gtcgatgtcgcctcccatcgccgcctggatgcgctcgatctcccccgnga ggtcctccg
Download
page-top