Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606353
Length 384 bp
Fasta Format > rwhv3n8i23
tgtggcacaccaagggaacgaaaaatacaaacatgaactgagaggaaata cagatacagacactcatttaggaacgtggacatgagcgagacgccggtgc ttttcttcagggcgatgccagctatatagaagtctaaaacccacaagttc agcttcagctcgtatgtatgtaagtcagctcatgaactagagatgatcat ggttcatggatggacagggaccccaggaaccaccaccagcgggccgttaa tggtactggttccggtaccggttcccaccaccggcaggtctggcaacccc gaacccgaagaagccttggactcggcgacgccggcaccgcgtgtcgctcc cagtgcgccgtccttctggctcagctccctcccg
Download
page-top