Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606244
Length 510 bp
Fasta Format > rwhv3n8c08
cgtacatgtggcacaccaagggaacgaaaaatacaaacatgaactgagag gaaatacagatacagacactcatttaggaacgtggacatgagcgagacgc cggtgcttttcttcagggcgatgccagctatatagaagtctaaaacccac aagttcagcttcagctcgtatgtatgtaagtcagctcatgaactagagat gatcatggttcatggatggacagggaccccaggaaccaccaccagcgggc cgttaatggtactggttccggtaccggttcccaccaccggcaggtctggc aaccccgaacccgaagaagccttggactcggcgacgccggcaccgcgtgt cgctcccagtgcgccgtccttctggctcagctccctcccgtcacaggacg cgagcaccaccaccaacagcagcgcgacggcgagacacttcgccattgct aactgggaggttctgaacttctgatactactgaggagacagtcttgcttt agcttgtgtg
Download
page-top