Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606200
Length 585 bp
Fasta Format > rwhv3n7p14
tgtacgctatatatcttcacaaaatgcaacaatatgtactgggcggaaat ctttaatatcaaggcataatgcccagcaaataaccaatacacaagcgccc ataataagtaaacaaacttaacaacatccaggacctgactctgaaccaaa ctgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttca aagacgatcaacccctcccaccttgacaccaacttaacgtaaagcaaaca caacacacgccaacaattcaatcgaggtccggtcacgagtctcgggcacg gcggcgatcaagcgctgggcttgtgctcgcctgcagcggcggcggccttg tcctcctcccctgtcttgtggtaaccaggcagcttgtccatgatcttgcc cagtaggcccttcttctccttcgcgtcagggctgctcacctcctcggcgg ctggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcacc ggagcagcgtcctccggtttcttgtggccgccgggcagcttctccttgat cttttccaagaagcctttcttctcctcctcgggca
Download
page-top