Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606178
Length 738 bp
Fasta Format > rwhv3n7o04
atgacacagaaccatccttcaaaatgaggcaacaagttgagattaacaca gatggcaatacgcggcagggtaactcttgtgatctagtgcttcttgttct tcgggatcttcgacaggaccttctcttcaaagatggcataatacttcttc aattcgatcatggccttctcaccaaaagcatccaccttgtcatcgtactt ctcatacagaactggcacagtgtacagcaccacaaagactatatatgaca gtgtcaaaaagttgcagtagctcccaagaacagaaagaagccagagccct ccaatcacaatgaggaatttcttcagatcacgaccatgaccagtctctct caaggtaaagaagccccggttgatctcatgccgcagtgatagtgcaatgt ttacagtcatgtcctccgggattttcacctcagggatgttcgggggagac ttgtggatgaaaatgcagacattggaatagaggaagagggttgccaggga gaggatgaggcagtggcccaccaaggtgagcagatggtactccatgacct cgaacagcagccagatggcagtagcgccagcaagcacccctccggagacc ttcttgttcctccatagaacaagatcagcaggcttgccgccgccgaggac ggcgtggacgggcttctcgcggccgaanaggcggtanatcttggccttga cncccgccgccgaccccttcttctcntcnnccnantcc
Download
page-top