Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ223834
Length 288 bp
Fasta Format > whdl7b02
gcagtacccctcccctcccctcccctcccccaacccaccggcggcggcgc agcgcagcttgaggaaggaagcgaagatggtgaagttcctgaagcccggn aaggcggtgatcctgctgcagggcaggtacgcggggaagaaggcggtgat cgtgcgcgtgttcgaggagggcacccgcgaccgcccgtacgggcactgcc tcgtcgccgggctggccaagtacccgaagaaggtgatccgcaaggactcg gccaagaagacggccaagaagtcccgcgtcaaggtgtt
Download
page-top