Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ605159
Length 516 bp
Fasta Format > rwhv3n3i07
agattgaatccagtacatgagacgatcatcaaaaggtttcacaaagtatg agctagcagtatttagacgacagataataggccaaaaatttcgactcagc cagaccagatgctacaaactgctctaacgaataggcagataggttatgta gagcttccttctctaggccttcctggcaatctgggactcagcctccttct tcaccggctcttccttctccgacaagatcagctcaatgtggcatgggttg gacatgtaggggttgatgcgtccatgggcacggtaggtccggcgccgctg cttctgggcctggttcacttggatgtgtgaaatgtagagagcatcaacat caagacctttcacctcagcattgctctcagcattctttagaagatccaga acgaacttagcagacttggcaggccagcgtccctgaccattgggctgacg gttcttcacctgggctgtgcgtccaacaccacggcagtacctccggaagg ggatggcttgcttgtg
Download
page-top