Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ605100
Length 904 bp
Fasta Format > rwhv3n3e03
agagatctgaccatacacttgctggcaaaatggaacttcaaataaagcta ttcgatgagaggcaacagaaggctggggcgataactcccaacccctgcaa agccaagaagacaaaaatcgatttccatctaacataactcagtactgtaa aaattaaatctacttaaccagcgtctaccaacaaagtactgacggggcaa ataacacagccttcacccataaaccgcggccgaactccttcactccacag tgccgagtagcataaaccttgggtcaagtccttcactcccagttcggagt agcagctggtgctgctgcgggtgcgggagcgctgccctgttcccagccag taggggcaggtgctggaactgcatcccatccatcggcagcaggagctgaa attcagaaatgtaatttgagtacaatttgaacatttcaggctaaaaaaat agtcaaactgataggcagagacagaaaaagaaaggacagaatagcaaatg gcatctggtaaaagggtaggataagaaatggggtatgaattcaatgtgaa caaacttgaaaacttactatccccagataaaggaaagaccatatagagat aaaattatactagaataaactaggacggcaggttgatctcaaatgtgggc tgaaactgagactagaggttgttcataaagttccaatctaattatgcaat tacaaaataagaatcttcattcaaacctggagcaccagtccactcggccc cagccggggcttcggcggcagcagctggagctgcagctcctggccattca gcaccccaggtatcccctgctggggcagtgtactctgcaactgcagcgta ctcaggagcncccnaagcttcatcttcctcaagctccttancttcctctg ggtc
Download
page-top