Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ605014
Length 631 bp
Fasta Format > rwhv3n2n20
acgaccaacttcttcttacacctaagtacaccccaaggtctcacgtacac aacaaacaagcaaagcacgaacggacgtacaattaatggccaaaaagcat tcgctcgtgccggtgccgatctagtcgtcctcctcgccgctgatgaactt gccggtgccggggttgatggcggcgatgaagaagaagacgacgttgaaga gcacgagcggctcgatctcgctgatgggcaccccggtctcgatgttgagc tgcgcgagcgcgcccttgcccgtgatgatctccccgatgatggagaaggc gatccccagctgcgccagccgccccacgaacagctcgttcgacttggtga acccgaacagcggccctccctcgctgaggccgagggcggagcggaagcct ttgccgggggcgatgacggccttgtcgaggccagtggtgggctgctcgtc gacgaacctgccacggtctccgagagcgccgatggcgccgaggagggtga agaggatgaagaanaggaggaggggctccncctcntanatcgggatgccg gtctcaangttcanctgggacangatgcccttgccngtgatggcctctcc cannatnnatgnnnnnaannnnntcntggna
Download
page-top