Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604507
Length 655 bp
Fasta Format > rwhv3n1l19
attttgtgacattcatgggggatcaatatcatgagtaggcgaggaagaaa caataacagaagctaaaatataaaccgacaccctgggtttagattactag atacacacacaaacacacattgttgcctcgattgtttcctctccaccgat caacccacgtacgcatgcacacaagatgagtatcttcacttctgctctgc tctagttagactcgagctgcgcgtaccacacaccctggatcttgacatcc ttgggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcgaa gacgccgatcacctcgccggtctccggcttgctcttggtgacgctgagcg tgatgttgcccgtggaggaggacgcgttcttcacgttctccttggccaac tcctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcgta gccagtagagccaccacggccctttgggtcgaggaaagacgaacccctgt agctgggcacgaggaagggcccgctgaagctctcgggcttgccggtggcg acnagctgcttgacggtgaanaggaagggcacgcgctcncctccggggan ctgcanggtgacngnnncnnanncnatgncnncnttctcntnnaanttna nggng
Download
page-top