Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604448
Length 687 bp
Fasta Format > rwhv3n1h12
ctcggtcgcatacatcaaacaaagttacaccaaggagtgtgtataaatca gtctcttgaaactgaaatttaatttatattgggggaataacaaaacgaaa ggagggcgagggtaagcaggcgcgtctaattatcgtttatgatcttcttg gtgccgctacccgcatcttatttgtctcctcccatcccgagtgtgttcat cacagcatccttggcacccgtcgcggcacccatcatattcccgccagcct gctggaagacgttttccttgggggcgaccgggggatccttggtgtactgt gcagcggtgtcttggacatactgcgcggcctcggtagacttctccttggc ggcgtcggtggtctcggtggccgtcttcttgacagcctcagtcttctcgc tgaggaagccgcccgtctggtctttgccctcgacggcgcgatccttcccg gcttccactgtctcggacgccttccccatggcctcgccacccatcttttt ggccgcctcantagtctcggaggcanccttcntgacagccgcgctcttct cgccaaggaagctgccggtctggtcttttncctcnacggcacngncctgg atggattgccccnnctcnnacncnatcttcttgnnctcnccngnctnaan ttgnnncannnnnnnnacctcccnnnanttnnnntna
Download
page-top