Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604445
Length 704 bp
Fasta Format > rwhv3n1h09
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaacctcttcgttcacggtaaagctctggt agatgaggacgcctccacaggggagctcctgctccacaacgttgttgcag tcgtatgcctcggcgtcgagcttcttgccccaggtggcggcgtggccgcg gccaccaaagatggtgaccgccgcagagaactctgaagggccaaagcacc ggaggaccctcttgacgatgtcgccgtaggccagggcggaggcgtccatg cccatgacctcgtagctcgcatagctgaagccgtcctcgggggtcacatg gatggtggagacggcagatccgttgatggcgttcatggantanccgcang gctcnaantcnnaantcacanacctccatctcnggaatgatgtcnganat acna
Download
page-top