Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604439
Length 666 bp
Fasta Format > rwhv3n1g24
aagctagtttgttattatctctttgcaacacaggttccatgccaccaatg gtcacttctctcaggacgcaagcgtttccattacagcttaactagtaacc acccctcagagcaaggacaagatggaggaccgagccaccttcgatgttgt agtccttggcagtcttgtcatctgcaagctgcttaccagcataaatcagc ctttgctgcacaggaggaatgccttctttctcctcaacacgctccttgat cctatcaatcgtgtcggtgggctcaatgtcgatttcgatctccttcccag tgagagtcttaaccttgatcatagtaccgcccctgagcctgaggaccaag tgaagagtcgactccttctgaatgttgtagtcagcaagcgtgcgtccatc ttccaactgcttgccagcgaatatcaaacgctgctgatccggaggaatcc cttccttgtcctggattttggccttgacgttgtcgatggtgtcgctgctc tcgacctcgagggtgatggtcttccccgtgagggtcttgacgaagatctg catcttctcgcgcccctgctgctcgtgcgtgcggtgcgggagggagtcaa gctgcaggtcgcgtgaggacgacggagcanaggcggaagcggacgaaaac gaaacgaaaatccttt
Download
page-top