Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604430
Length 362 bp
Fasta Format > rwhv3n1g06
tacacacaaggacaccatgggcatagcttggttacagcgagcaagcaaac cacacgcnnacgcanacgnacccttgctcgactccatcagatcagacgct cgttattcacgtatactctnacaccaacncacgtacgtacgagtgcatgc accttancagttgcaggggttgcacttgcagttgtcgccgcanctgcagc cctcgccggactgcccggcggccncntcgaactgccccgccttgntctca ngcgccacgccgaggacgaccaccgnggcgacntgggcggcggcnctgcc ctgctcngtcngatcagggtacatcttcccgcacttgcagtctgagctcg cagctgcaaccg
Download
page-top