Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604429
Length 681 bp
Fasta Format > rwhv3n1g05
tggacatacacatattcttaggaacaaataagaaagataaatggagaagg aaaacccaaagcaatgtcagagttgacaaaactgcaatggcactttatat atggcctgtcgtgagtgagctgtttaggccttgccggactcctcgcagcc cggtggcttgaaggcgatgaagctgacgcactgcacctgacgcatgttgt cgaatccgatgatgcggacataggcgtcagggtactccttcttgacctcc tccacctcgttgatcacctgcgtggcgtcggtgcatccgaacataggcag cttccacattgtccagtaccggccatcgtagtacccaggggatgcgttgt gctcacggaagatgaacccaaccttgctgaactcgaggcaaggcacccac ttggagcggatcaggtagtcgacctgcttaaggagggcctccgtgctgag cggtggcaagtaggacagggtctcgaacttcttgatgccctcgatgggcc acacctgcatgcacctgatccttccaccgttgctgacgctgccgaggcta gcgccgttggagcggcggctgacggggaggccggcggtggacttgagccc ctggaaaggagcgacggangtggccgacnaggccatcacngtgggggcca tggctgtactatgtangtatatancttgcta
Download
page-top