Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604424
Length 665 bp
Fasta Format > rwhv3n1f18
tgcccttttaattcacccgtaactgatttacaagtgaccaacatcatcta attcatcttaccaaaaccaaaaccaggaccaggaacataaatcaagatga taggtagactagctggtgctcgaccactgtcgtctgtccaagagaaaagg aagccaccgaccgagcaaacagtccataacttactgtaagtgataattag tctaatcgaggactaacaagtcttcgtctgtgaatatccggttgtacgac gaatccatgtcgtgcacgacgagcttctcagcggtgatgctggcgccggt ggcattgttgaacaggtagacccccgccgccgcgtaaatggcctccgtcg ggtaggcccttgatgtcgccgtcatcctcccgcccatcacgaagctctgc acgatggagtggtccacgagcaccctaacagacaaatcctcgctgtcgag caccggtaccgtgctacccaccacctccttcgccacatcggtagcatgtg tcgaccgcaactcatcgtggcagaagtgcgtccgaagaccaccgtcgagg cccttggacacataaaagtacaccgctgtctgttctgtcagggcgacgtt ggcgagaacgagaatgccaaaggggccgagtgcgccacgggtggcggcgc cgctggtcatggtgc
Download
page-top