Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604423
Length 759 bp
Fasta Format > rwhv3n1f16
ttctttccgagactcaggaagaaagagcagtatgaggaactacacaacaa agaatatgaaaagtgaaagtgacagagcgactaacagagcaaactgcaca tcactcagcagtttcagcgactcaaaatggaaaggataaatatatgaaat gacattaagaaacttagcactgactaccatacaacaagaccagtgtagag cgtcgcttcaatgtctaatgcttcttcccacttcccaggagcaacatgat cccgtcttgacgaacttgagaggcggcagaccaagagaatgccatgctct taggcagatgccttgtcgaacttgaggggcttcaccacctcccaggtgaa gtcggcatcatcacggccaaagtgaccgtaagcagcggtcttgatgaacc tgtttccacctttcttcaagtccaggttgatgctgatcatcccgggcctg aagtcaaagttctccttcacgagcttgaggatctccctgtcggggatctt gccggtgccgtaggagtcgacgaacacagacaaaggctcaggcacaccga tggcgtatgagatctgcacaatgcagcggcgtgcgaggccgctggcgatg atgctcttggcggcctgcctggcaatgtaggcgccactgcggtcgacctt ggttggggccttgccananaangcaccgccgccgtgggctccccnnccac catangtgtcnatgatgatcttgcngccngnganaccnnnncctcnngcc nanttcctg
Download
page-top